CleanEx
USER MANUAL

CleanEx June 2008

Current release is based on Unigene database available on : June 11 2008

CONTENTS

1. INTRODUCTION
2. SELECTION
3. FORMAT CONVENTIONS
1. The title line
2. CleanEx entries
1. The ID line
2. The DE line
3. The ON line
4. The RNA line
5. The DR lines
6. The EXP line
7. The // line
3. CleanEx_trg entries
1. The ID line
2. The OA line
3. The GN line
4. The GC line
5. The QU line
6. The SR line
7. The FM line
8. The FN line
9. The UG line
10. The F1-F16 lines
11. The DR line

1. APPENDIX A SURVEY OF LAST RELEASE
2. EXPRESSION DISPLAY

1 INTRODUCTION

CleanEx is an expression reference database. Its goal is to link different information found in known databases and public expression data. Entries are cross-linked with pages allowing users to view expression data locally as well as in the original published format.

2 ENTRY SELECTION

So far, CleanEx contains only human genes for which the symbol is approved by the HUGO nomenclature committee.
There is one entry per gene name.

3 FORMAT CONVENTIONS

3.1 The title line

The title line of CleanEx is shown below:

TI    CleanEx     EXPRESSION DATABASE

3.2 CleanEx entries

A CleanEx entry contains the following information :

• Gene name description and localisation
• Corresponding RNA sequences found in EMBL
• Cross-references to other databases
• Cross-references to available expression data

CleanEx entries are presented in a similar format as EMBL and SWISS-PROT sequence entries. Each line starts with a line code identifying the type of information presented. The current line types and line codes and the order in which they appear in an entry, are shown below:

	ID  - IDentification.
	DE  - DEscription.
	ON  - Old gene Name.
	RNA - RNA sequence in EMBL.
	DR  - Databases crosslinks.
	EXP - EXPression cross-references.	
	//  - Termination line.

Spacer lines (XX) are inserted in order to make the database easier to read by eye. Some line types occur many times in a single entry. Each entry must begin with an identification line (ID) and end with a terminator line (//). Text does not exceed column 72.Below is an example of an entry:

ID    HS_FN1     2q34.
XX
DE    fibronectin 1.
ON    none.
XX
RNA   EMBL; AF130095.1; AF130095.
RNA   EMBL; AF312399.1; AF312399.
RNA   EMBL; AJ276395.1; HSA276395.
RNA   EMBL; AJ320525.1; HSA320525.
RNA   EMBL; AJ320526.1; HSA320526.
RNA   EMBL; AJ320527.1; HSA320527.
RNA   EMBL; BC005858.1; BC005858.
RNA   EMBL; M10905.1; HSFNC.
RNA   EMBL; M27589.1; HSFNPFH1.
RNA   EMBL; M27590.1; HSFNPFHL1.
RNA   EMBL; U41724.1; U41724.
RNA   EMBL; U41850.1; U41850.
RNA   EMBL; U42404.1; U42404.
RNA   EMBL; U42455.1; U42455.
RNA   EMBL; U42456.1; U42456.
RNA   EMBL; U42457.1; U42457.
RNA   EMBL; U42458.1; U42458.
RNA   EMBL; U42592.1; U42592.
RNA   EMBL; U42593.1; U42593.
RNA   EMBL; U42594.1; U42594.
RNA   EMBL; U60067.1; U60067.
RNA   EMBL; U60068.1; U60068.
RNA   EMBL; X02761.1; HSFIB1.
XX
DR    Entrez GeneID; 2335.
DR    Unigene; Hs.339722.
DR    MIM; 135600.
DR    Genew; HGNC:3778; FN1.
DR    RefSeq; NM_002026.
DR    RefSeq; NM_054034.
DR    SWISSPROT; P02751; FINC_HUMAN.
DR    EPD; EP16038; HS_FINC.
XX
EXP   HSEST; HSEST_FN1; NM_002026.
EXP   LYMPHOMA1; L0001_15953; IMAGE_139009.
EXP   LYMPHOMA1; L0001_16112; IMAGE_139009.
EXP   LYMPHOMA1; L0001_17791; IMAGE_139009.
EXP   NCI60; NCI60_136798; IMAGE_136798.
EXP   NCI60; NCI60_151144; IMAGE_151144.
EXP   NCI60; NCI60_512275; IMAGE_512275.
EXP   NCI60; NCI60_512287; IMAGE_512287.
EXP   PEROU1; P0001_139009; IMAGE_139009.
EXP   PEROU1; P0001_268091; IMAGE_268091.
EXP   PEROU1; P0001_269203; IMAGE_269203.
EXP   PEROU1; P0001_296556; IMAGE_296556.
EXP   PEROU1; P0001_60846; IMAGE_60846.
EXP   ROSETTA; R0001_20907; RNA_X02761.
EXP   SERUM1; S0001_136798; IMAGE_136798.
EXP   SERUM1; S0001_151144; IMAGE_151144.
EXP   SERUM1; S0001_512275; IMAGE_512275.
EXP   SERUM1; S0001_512287; IMAGE_512287.
//

A detailed description of each line type is given below.

3.2.1 The ID line

The identification line is always the first line of an entry. The general form of the ID line is:

	ID    GENE_NAME     genetic_locus.

• GENE_NAME is the species code followed by the gene identifier which obeys the Human Gene Nomenclature rules
• The genetic_locus field is the cytogenetic location of the gene. It is cross-linked with the NCBI's genome map viewer

The ID line is terminated by a period.

3.2.2 The DE line

	DE    fibronectin 1.

The description lines contain general descriptive information about the gene. It is extracted from the Unigene corresponding entry. The description is given in ordinary English and is free-format. In some cases, more than one DE line is required; in this case, the text is divided only between words. The last DE line is terminated by a period.

3.2.3 The ON line

	ON    STGD1, ABCR, RP19, STGD.

The ON line describes the history of the gene nomenclature. It lists all the previous gene symbols which have been attributed to the specific gene.

3.2.4 The RNA line

	RNA   EMBL; M27590.1; HSFNPFHL1.

It contains cross-references to the mRNA entries for this gene. These mRNAs are found in the EMBL database. The RNA lines can refer to partial mRNAs.
The format of this line is given below :

	RNA   EMBL; EMBL_SV; EMBL_ID.

• EMBL_SV is the EMBL sequence version number.
• EMBL_ID is a secondary identifier or name for the EMBL entry.

The line is terminated by a period.

3.2.5 The DR lines

The DR lines contain cross-references to entries from other databases. So far, we have incorporated links to SWISS-PROT, Entrez GeneID, RefSeq, Unigene, GeneCards and EPD. The precise format of these lines depends on the target database.
The format of the DR line is shown by the following examples :

DR    Entrez GeneID; 2335.
DR    Unigene; Hs.339722.
DR    MIM; 135600.
DR    Genew; HGNC:3778; FN1.
DR    RefSeq; NM_002026.
DR    RefSeq; NM_054034.
DR    SWISSPROT; P02751; FINC_HUMAN.
DR    EPD; EP16038; HS_FN1.

• The first item on the DR line is the abbreviated name of the data collection to which reference is made. The currently defined data bank identifiers are the following:

Entrez Gene	A single query interface to curated sequence and descriptive information about genetic loci.
Unigene	The gene cluster database from NCBI.
MIM	The Mendelian Inheritance in Man Database, a catalog of human genes and genetic disorders.
Genew	The Human Gene Nomenclature Database providing data for all human genes which have approved symbols.
RefSeq	The NCBI Reference Sequence project.
SWISSPROT	Protein sequence database.
EPD	The eukaryotic promoter database.

• The second item is the primary accession number (or an equivalent unique identifier of another data bank) of the entry to which reference is made.
• The third item (if it exists) is a secondary identifier or name for the cross-referenced database entry. For Genew, this number is the HGNC (Hugo Gene Nomenclature Committee) identifier.

3.2.6 The EXP line

The EXP line contains cross-references to the human public available data on gene expression. An exhaustive list of datasets already integrated in CleanEx is available HERE.
Currently, the different data types considered for integration in CleanEx are :

1. Stanford cDNA arrays.
2. Nylon membrane arrays.
3. Affymetrix oligoarrays.
4. Other oligoarrays (Incyte, Resgen, Rosetta).
5. EST counts per tissue category and per gene.
6. SAGE experiments.
7. MPSS experiments.

The format of the EXP line is shown by the following examples.

EXP   HSEST; HSEST_FN1; NM_002026.
EXP   LYMPHOMA1; L0001_15953; IMAGE_139009.
EXP   NCI60; NCI60_136798; IMAGE_136798.
EXP   PEROU1; P0001_139009; IMAGE_139009.
EXP   ROSETTA; R0001_20907; RNA_X02761.
EXP   SERUM1; S0001_136798; IMAGE_136798.
EXP   AFFY001; AFFY001_1575_at; AFFY_HC-G110_1575_at.

• The first field of the EXP line is the abbreviated name of the data collection to which reference is made. The currently defined data bank identifiers are the following:
- PEROU1 for the data from Perou et al
- SERUM1 for the data from Iyer et al
- NCI60 for the data from Ross et al
- LYMPHOMA1
- ROSETTA
- AFFY001
- HSEST for the data from EST counts.
• The second field is the local identifier of the corresponding expression entry. It is built with the local code for the dataset (HSEST_ for ESTs, P0001_ for Perou and S0001_ for SERUM1...) followed by the clone number used for the experiment (mostly Image clone numbers). For the EST dataset, we used the HUGO official name
• The third field is the reference to the CleanEx_trg corresponding entry.

Users can visualize available expression data about the sequence given in the EXP line in two ways :

• First by using (if it exists) the link to the web site provided by the original authors of the expression dataset.
• Second by using a local visualiser. A few explanations about this display is given in Appendix B

3.2.7 The // line

The // (terminator) line contains no data or comments. It designates the end of an entry.

3.3 CleanEx_trg

Each CleanEx_trg entry corresponds to one "target" (or "expression feature") used in an expression measurement experiment. Identifiers are composed of a code which describes the target type followed by an underscore and the target accession number. Types could be, for example, IMAGE clone (IMAGE), Affymetrix probeset (AFFY), SAGE tags (SAGE), or EMBL RNA or DNA sequences (RNA,DNA).

The format of CleanEx_trg resembles that of CleanEx. Each CleanEx_trg entry contains the following information :

• ID CleanEx_trg ID
• OS Organism Species
• GC Gene Count
• GN Official HUGO Gene Symbol
• OA Original Annotation (if existing)
• QU QUality
• SR Sequence Reference
• FN Feature Number
• UG UniGene release
• F1 Feature
• DR CleanEx_ref ID
• //

Below is an example of an entry for an Affymetrix probe set :

ID   AFFY_HC-G110_1575_at   Type=Affy_Tag
OA   M14758; HUMMDR1 Human P-glycoprotein (MDR1) mRNA; complete cds.
OS   Homo sapiens (human).
GN   ABCB1
GC   1
QU   High
SR   Unigene=Hs.21330;
FM   Tag;
FN   16
UG   UniGene Build #160
F1  TGTCCAGGCTGGAACAAAGCGCCAG:283-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F2  AAAGCGCCAGTGAACTCTGACTGTA:284-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F3  GCGCCAGTGAACTCTGACTGTATGA:285-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F4  CCAGTGAACTCTGACTGTATGAGAT:286-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F5  TTAACATTTCCTCAGTCAAGTTCAG:287-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F6  ACATTTCCTCAGTCAAGTTCAGAGT:288-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F7  TTTCCTCAGTCAAGTTCAGAGTCTT:289-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F8  CCTCAGTCAAGTTCAGAGTCTTCAG:290-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F9  AGACATCATCAAGTGGAGAGAAATC:291-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F10  ATTTTCCCATTTGGACTGTAACTGA:292-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F11  TTCCCATTTGGACTGTAACTGACTG:293-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F12  CCATTTGGACTGTAACTGACTGCCT:294-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F13  TTTGGACTGTAACTGACTGCCTTGC:295-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F14  TAACTGACTGCCTTGCTAAAAGATT:296-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F15  CTGACTGCCTTGCTAAAAGATTATA:297-105; Refseq=NM_000927(+); Unigene=Hs.21330;
F16  ACTGCCTTGCTAAAAGATTATAGAA:298-105; Refseq=NM_000927(+); Unigene=Hs.21330;
DR   AFFY001_1575_at;
//

Description of the line formats :

3.3.1 The ID line

The identification line is always the first line of an entry. The general form of the ID line is:

        ID   TRG_ID     Type

• TRG_ID is the internal identifier for the entry. The first part of the ID is a target type identifier. The second part is built with the original target name (image clone identifier, Affymetrix chip and probeset name,...)
• The Type field is a description of the target's provenance. Type could be for example "Seq_Ref" (for a sequence in EMBL or in RefSeq), "cDNA_clone", "Affy_Tag", "SAGE_Tag"...

3.3.2 The OA line

        OA   X60188; Human ERK1 mRNA for protein serine/threonine kinase

This line contains either the target's Original Annotation found in the corresponding description files, for example the Affymetrix chips annotation, or the description of the sequence given in the corresponding EMBL entry. It exists only for CleanEx_trg entries corresponding to Affymetrix tags.

3.3.3 The GN line

        GN   TIE

The GN line lists the official gene symbols which correspond to that entry. If more than four genes match the target, only the four first ones are listed.

3.3.4 The GC line

        GC   1

The GC line gives the total count of genes having an approved symbol which match that target entry

3.3.5 The QU line

        QU   High

The QU line is a quality tag based on the precision of the mapping of the target.

This tag can take different values, according to the corresponding entry type or to the mapping protocol. For AFFY tags and IMAGE clones, the meaning of the four tags is :

• High : All the features of the target correspond to a maximum of two gene clusters.
• Medium : All the features of the target correspond to a maximum of four gene clusters. Three mismatches are allowed.
• Low : Criteria are below the ones of the "Medium" tag.
• Undefined : The target does not yet belong to a Unigene cluster.

For INCYTE clones, quality tags are a bit more stringent and correspond to the following criteria :

• 1 : Both 3' and 5' ends of the clone are available and match the same Unigene cluster.
• 2 : Either 3' or 5' ends of the clone are availableand both give a statistically significant result.
• 3 : Both 3' and 5' ends of the clone are available, but only one is statistically significant.
• 4 : No statistically significant result have been found.
• 5 : Both ends of the clone match different genes.
• 6 : The sequence is not yet available.

3.3.6 The SR line

        SR   Unigene=Hs.21330;

The SR line stands for Sequence Reference and gives the associated Unigene Cluster for the whole target.

3.3.7 The FM line

        FM   Tag;

This line describes the format of the features for the target.

3.3.8 The FN line

        FN   16

The FN line gives the number of features belonging to that target. For cDNA clones, this number is typically one. For Affymetrix probesets, it can vary between eleven to twenty-five.

3.3.9 The UG line

        UG   UniGene Build #160

The UG line shows the Unigene Release which has been used to map the target sequences to its corresponding cluster.

3.3.10 The F1-F25 lines

        F1  TGTCCAGGCTGGAACAAAGCGCCAG:283-105; Refseq=NM_000927(+); Unigene=Hs.21330;

These lines show the individual mapping for all the features of the corresponding target. Fields are separated by a ";". The first field is the name of the feature. The second fields contains the RefSeq accession number of the sequences which map the feature. The sign in parenthesis indicates if the tag mapped on the positive or on the negative strand of the RefSeq sequence. Last field shows the Unigene clusters to which the RefSeq sequences are associated.

3.3.4 The DR line

        DR   AFFY001_1575_at;

DR lines in CleanEx_trg are crosslinks to the expression data found in CleanEx under the line type "EXP". Link is done via the expression data local identifier.

---

APPENDIX A : SURVEY OF CleanEx LAST RELEASE

References from UniGene Build #213 Homo sapiens

Number of entries	21820
Number of RNA cross-references	124038
Number of Entrez GeneID cross-references	21699
Number of Unigene cross-references	19138
Number of Genew cross-references	21820
Number of RefSeq cross-references	24981
Number of EPD cross-references	1400
Number of SWISS-PROT cross-references	17755
Number of cross-references to EST count	17556
Number of cross-references to dual channel experiments	1886076
Number of cross-references to Affymetrix experiments	6423998
Number of cross-references to SAGE experiments	644525

References from UniGene Build #172 Mus musculus

Number of entries	36044
Number of RNA cross-references	48710
Number of Entrez GeneID cross-references	28468
Number of Unigene cross-references	18545
Number of MGD cross-references	36043
Number of RefSeq cross-references	26310
Number of EPD cross-references	115
Number of SWISS-PROT cross-references	14880
Number of cross-references to EST count	15715
Number of cross-references to Affymetrix experiments	1964526
Number of cross-references to SAGE experiments	421824

APPENDIX B : EXPRESSION DISPLAY

The local display gives different representations of the gene's expression.

1. The EST dataset :

   For the EST dataset, the ratio is the number of ESTs per gene for one category divided by the total number of ESTs for this category. This ratio is represented by a scale from white (underexpressed) to black (overexpressed).

2. Other datasets
   • In the first column, the color represents the log₂ of the ratio between the two channels (green and red). The color display goes from light green (underexpressed) to light red (overexpressed).
   • The second column displays the superposition of both scanned images

In any cases, the ratio color range goes from 1 to 256 and the value is scaled according to the following formula :
((logratio-logmin)/(logmax-logmin/256))
where logratio is the log₂ of the ratio, logmin is the minimum log ratio found in the dataset and logmax is its maximum.
For the display showing the sum of both channels, the color is obtained by superposing the intensity of both channels. Color value for each channel is scaled the same way than the color ratio value :
((logchannel-logminchannel)/(logmaxchannel-logminchannel/256))
where logchannel is the log₂ of the channel intensity, logminchannel is the minimum value of the log₂ channel intensity, and logmaxchannel is its maximum.